El quart aparell – INVESTIGA

Com a resutlat de tots els processos cel.lulars, els animals obtenen energia i poden fabricar la seva pròpia matèria orgànica. Però també apareixen substàncies de rebuig que han de ser expulsades de l’organisme perquè sinó podrien esdevenir tòxiques.

L’aparell que porta a terme aquest últim procés és l’excretor. Aquest també és diferent segons els animals.

Et demanem que busquis un o dos animals que ho facin per:

1- DIFUSIÓ

2- CONDUCTES EXCRETORS

3-APARELL EXCRETOR FORMAT DE RONYONS I CONDUCTES EXCRETORS

Els vertebrats terrestres  tenen un altre mètode per eliminar substàncies de rebuig mitjançant la producció d’una substància.

Quina deu ser aquesta substància?

Qui s’encarrega de fabricar-la?

Per què només ho tenen els vertebrats terrestres?

descarga

 

 

Sobre els experiments de Mendel – OBSERVA

Tot seguit tens una sèrie d’imatges referents als tres experiments de Mendel.

 

 

 

 

 

 

La important aportació de Chargaff – INVESTIGA

Una de les dades que van ajudar als seus descobridors a esbrinar l’estructura de la molècula de DNA van ser les dades que un altre científic: Chargaff va trobar i que es poden deduir de la següent taula. Per què penses que és tant important ?

A C T G
Humans 30% 20% 30% 20%
Xai 29% 21% 29% 21%
Pollastre 22% 28% 22% 28%
Blat 27% 23% 27% 23%
Llevat 32% 18% 32% 18%
Bacteri 23 27% 23% 27%

 

 

Les tres hipòtesis sobre la replicació del DNA – OBSERVA

Hi havia tres hipòtesis sobre el mecanisme de replicació del DNA: la semiconservativa, la conservativa i la dispersiva. Es representen a la següent imatge. En veus les diferències ? Sabries dir-les ?Per quina optes ?

Després veurem quina és la certa, com es va trobar i quines conseqüències té.

 

Grups sanguinis i sang artificial – PER FER A CLASSE – CLASSROOM

Resulta que científics del Institut Biotech de Massachussets estan dissenyant un dispositiu de la grandària d’una rentadora que converteix qualsevol sang humana en sang del tipus 0. Ja sabeu que la sang del grup 0 la pot rebre qualsevol persona, sigui del grup sanguini que sigui.

I com funciona la màquina? Doncs, es tracta de trobar enzims (un tipus de molècula) que digereix, trenca les molècules de sucre de la superfície dels glòbuls vermells que fan que una cèl·lula sigui A, B, AB o O. Recordeu que aquestes molècules les anomenem antígens. Si rebem una sang que te un antígen que nosaltres no tenim, llavors generem anticossos contra ella. Si això passa, el nostre sistema de defensa actua contra aquestes cèl·lules perquè són estranyes i rebutgem la sang. Amb aquesta màquina, treiem les molècules problemàtiques i la sang és acceptada sense cap trava pels sistemes de defensa.

Aquesta notícia ens dóna molta feina, us demanem que:

1. Descobriu què és un antigen i què és un anticos. 

2. Descobriu com actua el sistema de defensa del cos contra les molècules o cèl·lules que considera extranyes. 

Per les dues primeres preguntes en teniu prou consultant consultant aquí.

3. Qué són els grups sanguinis i quins tipus diferents hi ha ? 

4. Per què no es poden fer transfussions de sang de manera indiscriminada ? quina relació té això amb el sistema de defensa ?

Per les dues darreres en teniu prou consultant  aquí.

NO VOLEM CAP “Copiar y pegar” NOMÉS TEXT REDACTAT PER VOSALTRES. Si voleu podeu posar alguna imatge sempre que la citeu en el text.

Què és un gen ?

Aquest video et pot ajudar a saber què és un gen i què és el dogma general de la biologia. També afegim un enllaç (un cop dins cal que cliquis la pestanya “What is a gene ?”) que et vol donar una idea de la funció dels gens.

Va de proporcions – EXERCICIS

1. Donat el següent creuament: AaBb   x   Aabb quina proporció d’heterozigots per als dos gens podem esperar a la F1 ?

2. La proporció 9:3:3:1 obtinguda en el tercer experiment de Mendel és una proporció de fenotips o de genotips ? Justifica la resposta.

Genotips i fenotips – EXERCICIS

El caràcter alçada en una espècie de planta és determinat per una relació al·lèlica de dominància.

a) Quin serà el genotip de la F1 produïda pel creuament d’un planta alta pura amb  una planta baixa pura ?

b) Quina serà la probabilitat de distribució de fenotips a la F2 (resultat de l’autofecundació de la F1). Utilitza una terminologia adequada.

La transcripció i els tres tipus de RNA.

A continuació tens algunes imatges referents a la transcripció. Les dues primeres fan referència al procés pròpiament dit en el que s’aprecia l’enzim RNA-polimerassa que llegeix una de les dues cadenes de DNA per generar una cadena de RNA missatger (mRNA)

A la imatge següent (d’entrada una mica complicada) s’hi poden observar els tres tipus de RNA existents que es generen amb la transcripció i la funció que realitzen cada un d’ells.

 

Dominant i recessiu – EXERCICI

Digues si és possible que d’una parella amb els ulls negres en pugui néixer un fill també amb ulls negres i un fill amb ulls clars. Sàpigues que el color dels ulls ve determinant per un gen amb dos al·lels. L’al·lel dominant determina color fosc i el recessiu color clar.

Va de flors… – EXERCICI

Mirabilis jalapa (Exemple d’herència intermèdia)

En algunes plantes el color de la flor ve determinat per un gen amb dos al·lels que presenten una relació d’herència intermèdia. Si considerem que el color vermell es determina per l’al·lel dominant “R” i el color blanc pel recessiu “r”. Llavors la presència dels dos al·lels en el genotip “Rr” fa que el color resultant sigui un d’intermig entre el que determinen els dos al·lels per separat.

Sabent això digues quina serà la proporció de fenotips en els descendents d’un creuament entre dues plantes roses de Mirabilis jalapa.

Desxifrant el codi genètic – PRACTICA

Et vols posar a la pell dels científics que van desxifrar el codi genètic ? Si cliques aquí, trobaràs un missatge per desxifrar. Sàpigues que aquest és missatge és enormement més senzill de desxifrar que el codi genètic. Cada símbol correspon a una lletra de l’alfabet i les paraules estan separades per espais.

Així comprendràs la immensa feinada que va suposar entendre el llenguatge de la vida !

Quan n’hi ha més de dos… – TEORIA

Fins ara hem vist que cada gen té dos al·lels. Això és cert però cal matisar-ho.

En el genotip d’un individu sempre trobem dos al·lels per a cada gen, però dins l’espècie a què pertany aquell individu poden existir múltiples al·lels diferents. Això sí: cada individu només en té dos. Quan això es produeix parlem d’al·lelomorfisme múltiple.

La relació que es produeix entre els diferents al·lels pot ser diferent.

Per acabar-ho d’entendre podem fer el següent exercici:

Una sèrie de al·lels múltiples determina la intensitat de la pigmentació en el ratolí. D= color complet, d= color diluït i dl= és letal en homozigosi. L’ordre de dominància és :

D > d > dl

Un ratolí de color complet portador del gen letal es aparellat  amb un individu de color diluït també portador del gen letal. La F1 és creuada amb el pare diluït:

  • Quina proporció fenotípica pot esperar-se de la descendència viable ?
  • Quin percentatge de la descendència amb color complet és portadora del gen letal ?.
  • Quin percentatge de la descendència amb color diluït duu el gen letal ?
Exercici extret de: http://mmiguela.wordpress.com/genetic/

 

Teoria Cel·lular – INVESTIGA

A continuació tens una llista amb alguns noms de científics que van tenir un paper rellevant en la Teoria Cel·lular.

Et demano que facis una cerca  a la xarxa i trobis quines van ser les seves aportacions a aquesta teoria. El proper dia farem una posada en comú de les vostres troballes i el professor farà un resum de tot plegat.

No estaria de més que situessis en quina època passava tot això.

Quan ho tinguis fet ho lliures al classroom de la matèria. Codi: 1cc1oi7

Tasca: Teoria cel·lular

Robert Hooke

Anton Van Leeuwenhoeck

Theodor Schwann

Jakob Schleiden

Rudolf Virchow

Santiago Ramon y Cajal

El codi genètic – PRACTICA

Amb l’ajuda de la taula del codi genètic que tens a continuació fes els exercicis que se’t demanen.

Exercici 1

A partir de la següent doble hèlix de DNA i sabent que la cadena que porta informació és la de vermella, indica la seqüència d’aminoàcids de la proteïna corresponent:

ATGCCCACGGACCATTACCGGTAG
TACGGGTGCCTGGTAATGGCCATC

Fes el mateix en aquest segon cas:

TACCGATTTTGGCCGCTAATT
ATGGCTAAAACCGGCGATTAA

Exercici 2

Si el nombre d’aminoàcids que formen una proteïna és 1056, quants parells de nucleòtids, com a mínim, ha de portar el gen responsable de la seva síntesi ?

Exercici 3

Resol l’exercici que trobaràs clicant aquí.

Els cinc regnes – EXERCICI

Activitat per parelles / Cal que estigui en els apunts.

Observarem el següent video tots junts a la PDI (a continuació tu el pots tornar a mirar les vegades que faci falta). Es tractaria que intentis recollir les principals característiques de cada un dels regnes que es presenten. Anota-ho en els apunts i després ho posem en comú.

Tot seguit hi ha una llista amb els cinc regnes (en vermell) i algunes de les seves característiques principals. Es tracta que transformis aquestes dades en una taula de manera que en un sol cop d’ull es pugui veure tota la informació.

Un cop enllestit ho deixes al pou corresponent.

R. Mònera –> Procariota – Unicel·lular

R. Protoctist –> Eucariota – Unicel·lular

R. Vegetal –> Eucariota – Pluricel·lular – Fotosintètic – Immòbil

R. Fong –> Eucariota – Pluricel·lular – No fotosintètc – Immòbil

R. Animal –> Eucariota – Pluricel·lular – No fotosintètic – Mòbil


Jo guanyo, tu guanyes – TEORIA

Existeix un altre possible cas de relació al·lèlica. Es tracta de l’herència codominant.

Quan dos al·lels presentem codominància i es troben tots dos, el resultat és l’expressió completa d’ambdós gens.

Tal i com hem vist quan parlàvem d’al·lelomorfisme múltiple, en el cas de la codominància tampoc s’utilitzen lletres majúscules i minúscules per representar els al·lels (diferents variants del gen).  Aquí s’utilitza una lletra majúscula per representar el caràcter ( C pel color, T per la talla…) acompanyada d’un superíndex que indica la particularitat d’aquesta característica.

Gen Al·lels Genotips Fenotips
C CB (blanc)CN (negre) CB CB blanc
CB CN clapejat blanc i negre
CN CN negre
Taula extreta de: http://blocs.xtec.cat/biologia4mp

Els grups sanguinis un exemple de codominància – LLEGEIX

En els sistema ABO dels grups sanguinis s’utilitza la I/i per a designar l’al·lel i amb un superíndex s’assenyala l’antigen. A més aprofitem la I majúscula per indicar dominància i la i  minúscula recessivitat. Aquí teniu totes les combinacions possibles dels tres al·lels i el fenotip indicat amb una gradació de colors.

A continuació tens una fitxa explicativa molt interessant que t’explica el funcionament dels grups sanguinis. Fes-hi un cop d’ull !

Les mesures de la biologia – EXERCICI

Activitat per parelles / Cal que estigui en els apunts.

Recordes els factors de conversió ? Doncs fes una mica de práctica i pasa a mm cada una de les seguents mesures:

Longitud d’un espermatozoide 40 μm

Amplada d’un cloroplast 5μm

Diàmetre d’un eritròcit: 7μm

Cèl. Vegetal: 60μm

Virus del VIH: 10nm

Bacteri: 5μm

Una vegada fet clica el següent enllaç (prem “Start of animation” ) i digues quina és la mida de:

Glòbul vermell

Bacteri

Glòbul vermell

Cabell humà

Gra de pol·len

Virus

Glòbul blanc

Llevat

Àcar de la pols

Sistema circulatori doble, tancat i complet – DIARI DE CLASSE – PER FER A CLASSE

A continuació tens tres imatges que il·lustren tres característique essencials del sistema circulatori humà: es tracta d’un sistema DOBLE, TANCAT i COMPLET. Observa-les amb atenció i anota en el teu diari de classe què sognifica cada concepte. Si vols també pots imprimirles imatges i enganxar-les al diari.

 

circulacion

 

AD: Aurícula dreta; VD: Ventricle dret; AE: Aurícula esquerra; VE: ventricle esquerra.

 

 

 

 

 

circulatorio_abierto

En aquest cas et mostrem la imatge d’un sistema circulatori obert. El del cos humà és tancat. Saps veure quina és la diferència ?

 

 

 

 

completincomp

En aquesta darrera imatge (clica-la per fer-la més gran) s’aprecia què significa el concepte sistema complet/incomplet.

 

 

RECORDA QUE TOTA AQUESTA INFORMACIÓ SÓN CONCEPTES TEÒRICS QUE CAL APRENDRE !

La salinitat com a condició i algunes adaptacions – PENSA

Un dels principals efectes de la salinitat en els organismes és la pressió osmòtica que es produeix a banda i banda de les seves membranes com a conseqüència de la diferent concentració de sals. Ho recordes ? A continuació tens un parell d’imatges per refrescar la memòria.

Vacúols pulsàtils
Fenòmens osmòtics

 

 

 

 

 

 

 

 

 

 

 
A continuació tens un fragment de text en el que s’explica les estratègies d’alguns peixos en relació a la salinitat. Llegeix-los i assegura’t que en comprens el significat:

En los peces de agua dulce la presión osmótica interna es mayor que la del agua por lo que esta tiende a entrar por las membranas permeables en las branquias, las mucosas bucales y el intestino. Aunque también entran pequeñas cantidades por la piel. Para compensar esta entrada constante de agua los peces de agua dulce producen una orina abundante y altamente diluida que es hipotónica con relación al pez. Por lo que el mayor trabajo del riñón en los peces de agua dulce es la excreción de agua. 

En contraste con los anteriores, los peces marinos viven en un medio que es hipertónico, por lo que tienen a perder agua y ganar sales a través de sus membranas osmóticas. Para contrarrestar la pérdida de agua los peces marinos toman agua y así disminuyen la concentración de sales interna.

Las células de sal en los peces marinos eliminan el exceso de iones de cloro mientras que en los de agua dulce estas mismas lo toman. Estas células se han encontrado en las bases de las lamelas de las branquias, en las mucosas bucales y hasta en la cabeza.

En peces que migran regularmente entre el agua de mar y dulce (como el salmón y la anguila), el epitelio branquial cambia para adaptarse a la salinidad ambiental. Estos peces captan activamente NaCl (sal) cuando se encuentran en agua dulce y lo excretan (expulsan) activamente cuando se mueven en agua de mar.

La regulación osmótica está mediada por hormonas que afectan a la diferenciación celular y al metabolismo.

Finalment et demanem que pensis amb quin problema es deuen trobar les plantes que viuen en ambients on la salinitat és molt alta i com el solucionen (per exemple les plantes que viuen a les platges).

Salicornia

I també com a curiositat algunes imatges de la Mar Morta on la salinitat pot arribar  a valors de 226g/L. Suposo que no et ve de nou el nom d’aquest mar oi ?

Mar morta
Mar morta

La composició i l’estructura de la membrana – INVESTIGA

Activitat individual / Cal que estigui en els apunts / Es valorarà que en els apunts hi hagi les imatges d’aquesta entrada.

1. Sabries dir quina és la diferència entre composició i estructura ?

2. Quina de les dues coses penses que es va descobrir primer i per què ?

3. Busca, ni que sigui a la viquipedia, quina és la composició bàsica de la membrana. Cal que trobis com a mínim el nom de tres dels components majoritaris.

A continuació tens tres imatges que utilitzarem per explicar l’estructura bàsica de la membrana que a poc a poc s’anirà complicant.

La compensació gènica – INTERPRETA

Investiga en què consisteix el fenomen de la compensació gènica després ho comentarem tots junts.

Un dels efectes que té és l’aparició del corpuscle de Barr tal i com es posa de manifest en la imatge adjunta. Investiga què és aquest corpuscle i què té a veure amb la compensació.

Un altre efecte més específic que té aquest fenòmen és el que es demostra en el següent dibuix. Sabries dir què representa ? és a dir perquè aquest, és un exemple d’un efecte del fenomen de la compensació ?


El model del mosaic Fluid – OBSERVA i ANOTA

Activitat per parelles / Cal que estigui en els apunts /Es valorarà que en els apunts en net hi hagi les imatges de l’entrada comentades.

Tot seguit tens una galeria d’imatges sobre l’estructura de la membrana cel·lular. Observa-les amb atenció i anota tot allò que en descobreixis. En acabat ho posarem en comú.

Els creuaments recíprocs de Morgan – PRACTICA

Morgan detectà una mutació que afectava al gen que determina el color dels ulls en Drosophila. L’al·lel salvatge determina color vermell, mentre que l’al·lel mutat que ell descobrí determinava ulls blancs. L’al·lel salvatge domina sobre el mutat. Precisament gràcies als creuaments recíprocs que ara refarem, Morgan va concloure que aquesta mutació que anomenà “white” es trobava al cromosoma X.

La imatge que tens a continuació il·lustra el primer dels dos creuaments. Observa-la amb atenció i fes el creuament recíproc en els apunts. T’adonaràs que alguna cosa passa. Això és exactament el que va sorprendre a Morgan el 1909.

La membrana és fluida – OBSERVA

Activitat individual / Cal que en els apunts hi hagi un comentari sobre el que has après en aquest video.

Aquest video il·lustra de manera molt gràfica l’estructura i el comportament de la membrana. Val la pena fer-hi un cop d’ull.

Què són les mutacions ? – INVESTIGA

A continuació tens un text introductori senzill sobre les mutacions. Cerca’n les paraules importants i després estirarem el fil per entendre més de què es tracta.

The DNA sequences from two individuals of the same species are highly similar — differing by only about one nucleotide in 1,000. Each DNA difference results from a mutation — ranging from single nucleotide changes, to small repeated units, to larger insertions and deletions. Some mutations generate novel changes that are starting points of evolution, and some are responsible for disease. In humans, the vast majority of mutations occur in DNA regions that do not encode proteins. Most of these are neutral in terms of evolution or health; they have no negative or positive effect.

In the 1920s, DNA mutations were first induced in Drosophila using X-rays. Other types of ionizing radiation were also found to produce mutations. Ultraviolet radiation, a component of sunlight, causes specific kinds of DNA damage, including the linking of adjacent thymine nucleotides. Chemicals from a variety of man-made and natural sources are known mutagens. Also, DNA replication, itself, is not perfect and is a source of new mutations.

Un experiment genial amb dos errors genials – LLEGEIX

Activitat individual / Cal que estigui en els apunts.

Clicant aquí coneixereu l’experiment que va permetre descobrir que la membrana cel·lular estava formada per una bicapa de fosfolípids.

Llegiu-lo amb atenció i feu una llista de les paraules clau. després entre tots en buscarem el significat que anotareu al costat de cada paraula de la llista.